[1]:
%load_ext autoreload
%autoreload 2
import anndata
anndata.logging.anndata_logger.addFilter(
lambda r: not r.getMessage().startswith("storing")
and r.getMessage().endswith("as categorical.")
)
[2]:
import scirpy as ir
import scanpy as sc
from glob import glob
import pandas as pd
import tarfile
import anndata
import warnings
sc.set_figure_params(figsize=(4, 4))
sc.settings.verbosity = 2 # verbosity: errors (0), warnings (1), info (2), hints (3)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/traitlets/traitlets.py:3030: FutureWarning: --rc={'figure.dpi': 96} for dict-traits is deprecated in traitlets 5.0. You can pass --rc <key=value> ... multiple times to add items to a dict.
warn(
Loading adaptive Immune Receptor (IR)-sequencing data with Scirpy¶
In this notebook, we demonstrate how single-cell IR-data can be imported into
an AnnData
object for the use with Scirpy. To learn more about
AnnData and how Scirpy makes use of it, check out the data structure section.
The example data used in this notebook are available from the Scirpy repository.
Important
The Scirpy data model
Currently, the Scirpy data model has the following constraints:
BCR and TCR chains are supported. Chain loci must be valid Chain locus, i.e. one of TRA, TRG, IGK, or IGL (chains with a VJ junction) or TRB, TRD, or IGH (chains with a VDJ junction).
Each cell can contain up to two VJ and two VDJ chains (Dual IR). Excess chains are ignored (those with lowest read count/UMI count) and cells flagged as Multichain-cell.
Non-productive chains are ignored. CellRanger, TraCeR, and the AIRR rearrangment format flag these cells appropriately. When reading custom formats, you need to pass the flag explicitly or filter the chains beforehand.
Excess chains, non-productive chains, or chains with invalid loci are serialized to JSON and stored in the extra_chains column. They are not used by scirpy except when exporting the AnnData object to AIRR format.
For more information, see Immune receptor (IR) model.
Note
IR quality control
After importing the data, we recommend running the
scirpy.tl.chain_qc()
function. It willidentify the Receptor type and Receptor subtype and flag cells as ambiguous that cannot unambigously be assigned to a certain receptor (sub)type, and
flag cells with orphan chains (i.e. cells with only a single detected cell) and multichain-cells (i.e. cells with more than two full pairs of VJ- and VDJ-chains).
We recommend excluding multichain- and ambiguous cells as these likely represent doublets
Based on the orphan chain flags, the corresponding cells can be excluded. Alternatively, these cells can be matched to clonotypes on a single chain only, by using the receptor_arms=”any” parameter when running
scirpy.tl.define_clonotypes()
.
Loading data from 10x Genomics CellRanger, TraCeR, BraCer or AIRR-compliant tools¶
We provide convenience functions to load data from CellRanger, TraCeR, or BraCeR with a single function call, supporting both data generated on the 10x and Smart-seq2 sequencing platforms, respectively. Moreover, we support importing data in the community-standard AIRR rearrangement schema.
|
Read IR data from 10x Genomics cell-ranger output. |
|
Read data from TraCeR ([SLonnbergP+16]). |
|
|
|
Read data from AIRR rearrangement format. |
|
Read 10x data¶
With read_10x_vdj()
we can load filtered_contig_annotations.csv or contig_annotations.json files as they are produced by CellRanger.
Here, we demonstrate how to load paired single cell transcriptomics and TCR sequencing data from COVID19 patients
from GSE145926 ([LLY+20]).
[3]:
# Load the TCR data
adata_tcr = ir.io.read_10x_vdj(
"example_data/liao-2019-covid19/GSM4385993_C144_filtered_contig_annotations.csv.gz"
)
# Load the associated transcriptomics data
adata = sc.read_10x_h5(
"example_data/liao-2019-covid19/GSM4339772_C144_filtered_feature_bc_matrix.h5"
)
reading example_data/liao-2019-covid19/GSM4339772_C144_filtered_feature_bc_matrix.h5
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
(0:00:00)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
This particular sample only has a detected TCR for a small fraction of the cells:
[4]:
adata_tcr.shape
[4]:
(136, 0)
[5]:
adata.shape
[5]:
(3716, 33539)
Next, we integrate both the TCR and the transcriptomics data into a single anndata.AnnData
object
using scirpy.pp.merge_with_ir()
:
[6]:
ir.pp.merge_with_ir(adata, adata_tcr)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
Now, we can use TCR-related variables together with the gene expression data. Here, we visualize the cells with a detected TCR on the UMAP plot. It is reassuring that the TCRs coincide with the T-cell marker gene CD3.
[7]:
sc.pp.log1p(adata)
sc.pp.pca(adata, svd_solver="arpack")
sc.pp.neighbors(adata)
sc.tl.umap(adata)
sc.pl.umap(adata, color=["has_ir", "CD3E"])
computing PCA
with n_comps=50
finished (0:00:01)
computing neighbors
using 'X_pca' with n_pcs = 50
finished (0:00:03)
computing UMAP
finished (0:00:06)

Read Smart-seq2 data processed with TraCeR¶
TraCeR ([SLonnbergP+16]) is a method commonly used to extract TCR sequences from data generated with Smart-seq2 or other full-length single-cell sequencing protocols. Nf-core provides a full pipeline for processing Smart-seq2 sequencing data.
The scirpy.io.read_tracer()
function obtains its TCR information from the .pkl file
in the filtered_TCR_seqs folder TraCeR generates for each cell.
For this example, we load the ~500 cells from triple-negative breast cancer patients from GSE75688 ([CEL+17]). The raw data has been processed using the aforementioned Smart-seq2 pipeline from nf-core.
[8]:
# extract data
with tarfile.open("example_data/chung-park-2017.tar.bz2", "r:bz2") as tar:
tar.extractall("example_data/chung-park-2017")
[9]:
# Load transcriptomics data from count matrix
expr_chung = pd.read_csv("example_data/chung-park-2017/counts.tsv", sep="\t")
# anndata needs genes in columns and samples in rows
expr_chung = expr_chung.set_index("Geneid").T
adata = sc.AnnData(expr_chung)
adata.shape
[9]:
(563, 23438)
[10]:
adata_tcr.obs
[10]:
multi_chain | extra_chains | is_cell | high_confidence | IR_VJ_1_c_call | IR_VJ_2_c_call | IR_VDJ_1_c_call | IR_VDJ_2_c_call | IR_VJ_1_consensus_count | IR_VJ_2_consensus_count | ... | IR_VDJ_2_sequence_id | IR_VJ_1_v_call | IR_VJ_2_v_call | IR_VDJ_1_v_call | IR_VDJ_2_v_call | IR_VJ_1_v_cigar | IR_VJ_2_v_cigar | IR_VDJ_1_v_cigar | IR_VDJ_2_v_cigar | has_ir | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
obs_names | |||||||||||||||||||||
AAACGGGCAGTAAGAT-1 | False | [] | True | True | TRAC | NaN | TRBC2 | NaN | 40742.0 | NaN | ... | NaN | TRAV12-2 | NaN | TRBV15 | NaN | NaN | NaN | NaN | NaN | True |
AAAGCAATCCGGGTGT-1 | False | [{"c_call": "TRBC2", "consensus_count": 7866, ... | True | True | TRAC | NaN | TRBC2 | NaN | 32200.0 | NaN | ... | NaN | TRAV12-2 | NaN | TRBV15 | NaN | NaN | NaN | NaN | NaN | True |
AAATGCCAGAAGGTGA-1 | False | [{"c_call": "TRAC", "consensus_count": 13546, ... | True | True | TRAC | NaN | TRBC1 | NaN | 37692.0 | NaN | ... | NaN | TRAV21 | NaN | TRBV4-1 | NaN | NaN | NaN | NaN | NaN | True |
AACCATGTCCCTGACT-1 | False | [{"c_call": "TRBC1", "consensus_count": 27398,... | True | True | TRAC | NaN | TRBC2 | NaN | 20780.0 | NaN | ... | NaN | TRAV4 | NaN | TRBV24-1 | NaN | NaN | NaN | NaN | NaN | True |
AACCGCGGTATTACCG-1 | False | [{"c_call": "TRBC1", "consensus_count": 38186,... | True | True | TRAC | NaN | TRBC2 | NaN | 21536.0 | NaN | ... | NaN | TRAV1-2 | NaN | TRBV12-4 | NaN | NaN | NaN | NaN | NaN | True |
... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... |
TTAGGACAGGGTGTGT-1 | False | [] | True | True | TRAC | NaN | TRBC2 | NaN | 22304.0 | NaN | ... | NaN | TRAV8-3 | NaN | TRBV12-4 | NaN | NaN | NaN | NaN | NaN | True |
TTCCCAGAGGCTATCT-1 | False | [] | True | True | TRAC | NaN | TRBC2 | NaN | 11806.0 | NaN | ... | NaN | TRAV12-2 | NaN | TRBV6-5 | NaN | NaN | NaN | NaN | NaN | True |
TTGCCGTGTGCATCTA-1 | False | [] | True | True | TRAC | NaN | TRBC1 | NaN | 21220.0 | NaN | ... | NaN | TRAV17 | NaN | TRBV20-1 | NaN | NaN | NaN | NaN | NaN | True |
TTGCGTCAGAGTAATC-1 | False | [] | True | True | TRAC | NaN | TRBC2 | NaN | 21436.0 | NaN | ... | NaN | TRAV29/DV5 | NaN | TRBV6-6 | NaN | NaN | NaN | NaN | NaN | True |
TTGGAACGTACATGTC-1 | False | [] | True | True | TRAC | TRAC | TRBC1 | NaN | 33084.0 | 7762.0 | ... | NaN | TRAV19 | TRAV17 | TRBV9 | NaN | NaN | NaN | NaN | NaN | True |
136 rows × 77 columns
[11]:
# Load TCR data and merge it with transcriptomics data
adata_tcr = ir.io.read_tracer("example_data/chung-park-2017/tracer/")
ir.pp.merge_with_ir(adata, adata_tcr)
[12]:
sc.pp.highly_variable_genes(adata, flavor="cell_ranger", n_top_genes=3000)
sc.pp.log1p(adata)
sc.pp.pca(adata, svd_solver="arpack")
sc.pp.neighbors(adata)
sc.tl.umap(adata)
sc.pl.umap(adata, color=["has_ir", "CD3E"])
If you pass `n_top_genes`, all cutoffs are ignored.
extracting highly variable genes
finished (0:00:00)
computing PCA
on highly variable genes
with n_comps=50
finished (0:00:00)
computing neighbors
using 'X_pca' with n_pcs = 50
finished (0:00:00)
computing UMAP
finished (0:00:01)

Read an AIRR-compliant rearrangement table¶
We generated example data using immuneSIM ([WAY+20]). The data consists of 100 cells and does not include transcriptomics data.
The rearrangement tables are often organized into separate tables per chain. Therefore, scirpy.io.read_airr()
supports
specifiying multiple tsv files at once. This would have the same effect as concatenating them before
the import.
[13]:
adata = ir.io.read_airr(
[
"example_data/immunesim_airr/immunesim_tra.tsv",
"example_data/immunesim_airr/immunesim_trb.tsv",
]
)
ir.tl.chain_qc(adata)
The dataset does not come with transcriptomics data. We can, therefore, not show the UMAP plot highlighting cells with TCRs, but we can still use scirpy to analyse it. Below, we visualize the clonotype network connecting cells with similar CDR3 sequences.
Note: The cutoff of 25 was chosen for demonstration purposes on this small sample dataset. Usually a smaller cutoff is more approriate.
[14]:
ir.pp.ir_dist(adata, metric="alignment", sequence="aa", cutoff=25)
Computing sequence x sequence distance matrix for VJ sequences.
100%|██████████| 3/3 [00:00<00:00, 27.55it/s]
Computing sequence x sequence distance matrix for VDJ sequences.
100%|██████████| 3/3 [00:00<00:00, 28.09it/s]
[15]:
ir.tl.define_clonotype_clusters(
adata,
metric="alignment",
sequence="aa",
receptor_arms="any",
dual_ir="primary_only",
)
ir.tl.clonotype_network(adata, size_aware=False, metric="alignment", sequence="aa")
ir.pl.clonotype_network(
adata,
color="cc_aa_alignment",
base_size=20,
panel_size=(6, 6),
show_legend=False,
show_size_legend=False,
)
Initializing lookup tables.
Computing clonotype x clonotype distances.
100%|██████████| 100/100 [00:00<00:00, 644.12it/s]
Stored clonal assignments in `adata.obs["cc_aa_alignment"]`.
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
[15]:
<AxesSubplot:title={'center':'cc_aa_alignment'}>

Creating AnnData objects from other formats¶
Often, immune receptor (IR) data are just provided as a simple table listing the CDR3 sequences for each cell.
We provide a generic data structure for cells with IRs, which can then be converted into
an AnnData
object.
|
Data structure for a Cell with immune receptors. |
|
If you believe you are working with a commonly used format, consider sending a feature request for a read_XXX function.
For this example, we again load the triple-negative breast cancer data from [CEL+17]. However, this time, we retrieve the TCR data from a separate summary table containing the TCR information (we generated this table for the sake of the example, but it could as well be a supplementary file from the paper).
Such a table typically contains information about
CDR3 sequences (amino acid and/or nucleotide)
The Chain locus, e.g. TRA, TRB, or IGH.
expression of the receptor chain (e.g. count, UMI, transcripts per million (TPM))
the V(D)J genes for each chain
information if the chain is productive.
[16]:
tcr_table = pd.read_csv(
"example_data/chung-park-2017/tcr_table.tsv",
sep="\t",
index_col=0,
na_values=["None"],
true_values=["True"],
)
tcr_table
[16]:
cell_id | cdr3_alpha | cdr3_nt_alpha | count_alpha | v_alpha | j_alpha | cdr3_beta | cdr3_nt_beta | count_beta | v_beta | d_beta | j_beta | productive_alpha | productive_beta | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
0 | SRR2973278 | AVSDIHASGGSYIPT | GCTGTTTCGGATATTCATGCATCAGGAGGAAGCTACATACCTACA | 9.29463 | TRAV21 | TRAJ6 | ASSWWQNTEAF | GCCAGCAGCTGGTGGCAGAACACTGAAGCTTTC | 37.5984 | TRBV5-1 | NaN | TRBJ1-1 | True | True |
1 | SRR2973305 | AVVTGANSKLT | GCTGTGGTAACTGGAGCCAATAGTAAGCTGACA | 89.45740 | TRAV22 | TRAJ56 | NaN | NaN | NaN | NaN | NaN | NaN | True | True |
2 | SRR2973371 | ALKRTGNTPLV | GCTCTGAAAAGAACAGGAAACACACCTCTTGTC | 431.96500 | TRAV9-2 | TRAJ29 | ASRSRDSGEPQH | GCCAGCAGGAGCAGGGACAGCGGAGAGCCCCAGCAT | 952.0230 | TRBV10-2 | TRBD1 | TRBJ1-5 | True | True |
3 | SRR2973377 | ATDPETSGSRLT | GCTACGGACCCAGAAACCAGTGGCTCTAGGTTGACC | 772.43600 | TRAV17 | TRAJ58 | NaN | NaN | NaN | NaN | NaN | NaN | True | True |
4 | SRR2973403 | AVRGATDSWGKFQ | GCTGTGAGAGGAGCAACTGACAGCTGGGGGAAATTCCAG | 95.63640 | TRAV3 | TRAJ24 | SVQTSEYEQY | AGCGTCCAGACTAGCGAGTACGAGCAGTAC | 205.8330 | TRBV29-1 | TRBD2 | TRBJ2-7 | True | True |
... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... |
85 | SRR5023618 | NaN | NaN | NaN | NaN | NaN | ASSDSPFSSYNEQF | GCCAGCAGTGACTCGCCCTTTAGCTCCTACAATGAGCAGTTC | 864.4550 | TRBV6-4 | NaN | TRBJ2-1 | True | True |
86 | SRR5023621 | AENSGGSNYKLT | GCAGAGAATAGTGGAGGTAGCAACTATAAACTGACA | 512.63000 | TRAV13-2 | TRAJ53 | ASSPDGGGGYT | GCCAGCAGCCCTGATGGGGGAGGGGGCTACACC | 805.2010 | TRBV7-3 | TRBD2 | TRBJ1-2 | True | True |
87 | SRR5023626 | ALRIGSNYKLT | GCTCTGAGAATCGGTAGCAACTATAAACTGACA | 12.51630 | TRAV9-2 | TRAJ53 | NaN | NaN | NaN | NaN | NaN | NaN | True | True |
88 | SRR5023633 | NaN | NaN | NaN | NaN | NaN | ASGLGQSVGGTQY | GCTAGTGGCCTAGGGCAGTCGGTAGGAGGGACCCAGTAC | 18.4273 | TRBV12-5 | TRBD2 | TRBJ2-5 | True | True |
89 | SRR5023639 | NaN | NaN | NaN | NaN | NaN | ASSKGSLGPAGELF | GCCAGCAGCAAAGGATCGCTGGGGCCCGCCGGGGAGCTGTTT | 905.9260 | TRBV21-1 | TRBD1 | TRBJ2-2 | True | True |
90 rows × 14 columns
Our task is now to dissect the table into AirrCell
objects.
Each AirrCell
can have an arbitrary number of chains. A chain is simply represented as a Python
dictionary following the AIRR Rearrangement Schema.
When converting the AirrCell
objects into an AnnData
object,
scirpy will only retain at most two alpha and two beta chains per cell and flag cells which exceed
this number as multichain cells. For more information, check the page about our Immune receptor (IR) model.
[17]:
tcr_cells = []
for idx, row in tcr_table.iterrows():
cell = ir.io.AirrCell(cell_id=row["cell_id"])
alpha_chain = ir.io.AirrCell.empty_chain_dict()
beta_chain = ir.io.AirrCell.empty_chain_dict()
alpha_chain.update(
{
"locus": "TRA",
"junction_aa": row["cdr3_alpha"],
"junction": row["cdr3_nt_alpha"],
"consensus_count": row["count_alpha"],
"v_call": row["v_alpha"],
"j_call": row["j_alpha"],
"productive": row["productive_alpha"],
}
)
beta_chain.update(
{
"locus": "TRB",
"junction_aa": row["cdr3_beta"],
"junction": row["cdr3_nt_beta"],
"consensus_count": row["count_beta"],
"v_call": row["v_beta"],
"d_call": row["d_beta"],
"j_call": row["j_beta"],
"productive": row["productive_beta"],
}
)
cell.add_chain(alpha_chain)
cell.add_chain(beta_chain)
tcr_cells.append(cell)
Now, we can convert the list of AirrCell
objects using scirpy.io.from_airr_cells()
.
[18]:
adata_tcr = ir.io.from_airr_cells(tcr_cells)
[19]:
adata_tcr.obs
[19]:
multi_chain | extra_chains | IR_VJ_1_consensus_count | IR_VJ_2_consensus_count | IR_VDJ_1_consensus_count | IR_VDJ_2_consensus_count | IR_VJ_1_d_call | IR_VJ_2_d_call | IR_VDJ_1_d_call | IR_VDJ_2_d_call | ... | IR_VDJ_2_sequence_id | IR_VJ_1_v_call | IR_VJ_2_v_call | IR_VDJ_1_v_call | IR_VDJ_2_v_call | IR_VJ_1_v_cigar | IR_VJ_2_v_cigar | IR_VDJ_1_v_cigar | IR_VDJ_2_v_cigar | has_ir | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
cell_id | |||||||||||||||||||||
SRR2973278 | False | [] | 9.29463 | NaN | 37.5984 | NaN | NaN | NaN | NaN | NaN | ... | NaN | TRAV21 | NaN | TRBV5-1 | NaN | NaN | NaN | NaN | NaN | True |
SRR2973305 | False | [{"consensus_count": null, "d_call": null, "d_... | 89.45740 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ... | NaN | TRAV22 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | True |
SRR2973371 | False | [] | 431.96500 | NaN | 952.0230 | NaN | NaN | NaN | TRBD1 | NaN | ... | NaN | TRAV9-2 | NaN | TRBV10-2 | NaN | NaN | NaN | NaN | NaN | True |
SRR2973377 | False | [{"consensus_count": null, "d_call": null, "d_... | 772.43600 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ... | NaN | TRAV17 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | True |
SRR2973403 | False | [] | 95.63640 | NaN | 205.8330 | NaN | NaN | NaN | TRBD2 | NaN | ... | NaN | TRAV3 | NaN | TRBV29-1 | NaN | NaN | NaN | NaN | NaN | True |
... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... | ... |
SRR5023618 | False | [{"consensus_count": null, "d_call": null, "d_... | NaN | NaN | 864.4550 | NaN | NaN | NaN | NaN | NaN | ... | NaN | NaN | NaN | TRBV6-4 | NaN | NaN | NaN | NaN | NaN | True |
SRR5023621 | False | [] | 512.63000 | NaN | 805.2010 | NaN | NaN | NaN | TRBD2 | NaN | ... | NaN | TRAV13-2 | NaN | TRBV7-3 | NaN | NaN | NaN | NaN | NaN | True |
SRR5023626 | False | [{"consensus_count": null, "d_call": null, "d_... | 12.51630 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | ... | NaN | TRAV9-2 | NaN | NaN | NaN | NaN | NaN | NaN | NaN | True |
SRR5023633 | False | [{"consensus_count": null, "d_call": null, "d_... | NaN | NaN | 18.4273 | NaN | NaN | NaN | TRBD2 | NaN | ... | NaN | NaN | NaN | TRBV12-5 | NaN | NaN | NaN | NaN | NaN | True |
SRR5023639 | False | [{"consensus_count": null, "d_call": null, "d_... | NaN | NaN | 905.9260 | NaN | NaN | NaN | TRBD1 | NaN | ... | NaN | NaN | NaN | TRBV21-1 | NaN | NaN | NaN | NaN | NaN | True |
90 rows × 67 columns
[20]:
# We can re-use the transcriptomics data from above...
adata = sc.AnnData(expr_chung)
# ... and merge it with the TCR data
ir.pp.merge_with_ir(adata, adata_tcr)
[21]:
sc.pp.highly_variable_genes(adata, flavor="cell_ranger", n_top_genes=3000)
sc.pp.log1p(adata)
sc.pp.pca(adata, svd_solver="arpack")
sc.pp.neighbors(adata)
sc.tl.umap(adata)
sc.pl.umap(adata, color=["has_ir", "CD3E"])
If you pass `n_top_genes`, all cutoffs are ignored.
extracting highly variable genes
finished (0:00:00)
computing PCA
on highly variable genes
with n_comps=50
finished (0:00:00)
computing neighbors
using 'X_pca' with n_pcs = 50
finished (0:00:00)
computing UMAP
finished (0:00:01)

Combining multiple samples¶
It is quite common that the sequncing data is split up in multiple samples.
To combine them into a single object, we load each sample independently using one of the approaches described
in this document. Then, we combine them using anndata.concat()
.
Here is a full example loading and combining three samples from the COVID19 study by [LLY+20].
[22]:
# define sample metadata. Usually read from a file.
samples = {
"C144": {"group": "mild"},
"C146": {"group": "severe"},
"C149": {"group": "healthy control"},
}
[23]:
# Create a list of AnnData objects (one for each sample)
adatas = []
for sample, sample_meta in samples.items():
gex_file = glob(f"example_data/liao-2019-covid19/*{sample}*.h5")[0]
tcr_file = glob(f"example_data/liao-2019-covid19/*{sample}*.csv.gz")[0]
adata = sc.read_10x_h5(gex_file)
adata_tcr = ir.io.read_10x_vdj(tcr_file)
ir.pp.merge_with_ir(adata, adata_tcr)
adata.obs["sample"] = sample
adata.obs["group"] = sample_meta["group"]
# concatenation only works with unique gene names
adata.var_names_make_unique()
adatas.append(adata)
reading example_data/liao-2019-covid19/GSM4339772_C144_filtered_feature_bc_matrix.h5
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
(0:00:00)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
reading example_data/liao-2019-covid19/GSM4339774_C146_filtered_feature_bc_matrix.h5
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
(0:00:00)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
reading example_data/liao-2019-covid19/GSM4475052_C149_filtered_feature_bc_matrix.h5
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
(0:00:00)
Variable names are not unique. To make them unique, call `.var_names_make_unique`.
WARNING: Non-standard locus name ignored: Multi
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
[24]:
# Merge anndata objects
adata = anndata.concat(adatas)
Observation names are not unique. To make them unique, call `.obs_names_make_unique`.
The data is now integrated in a single object. Again, the detected TCRs coincide with CD3E
gene expression. We clearly observe batch effects between the samples – for a meaningful downstream analysis further processing steps such as highly-variable gene filtering and batch correction are necessary.
[25]:
sc.pp.log1p(adata)
sc.pp.pca(adata, svd_solver="arpack")
sc.pp.neighbors(adata)
sc.tl.umap(adata)
sc.pl.umap(adata, color=["has_ir", "CD3E", "sample"])
computing PCA
with n_comps=50
finished (0:00:09)
computing neighbors
using 'X_pca' with n_pcs = 50
finished (0:00:16)
computing UMAP
finished (0:00:07)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
/opt/hostedtoolcache/Python/3.8.11/x64/lib/python3.8/site-packages/anndata/_core/anndata.py:1220: FutureWarning: The `inplace` parameter in pandas.Categorical.reorder_categories is deprecated and will be removed in a future version. Removing unused categories will always return a new Categorical object.
c.reorder_categories(natsorted(c.categories), inplace=True)
